Saved Papers

Save papers so you can find them more easily!

Join Now

Get instant access to over 100,000 papers.

Join Now!

Nlm Analysis

Part I
Logistic Business
Transportation, Process to manufactures & 3 keys
Shipper needs to ship product or goods by using Carrier to Receiver

3rd Party Logistics Provider / Service

Shipper Receiver





Type of 3PLs

Asset-Based Non-Asset-Based

Revenue 100% 100%
COGS 80 – 85% 70 - 74%
Gross Profit Margin 15 – 20% 26 – 30%

Asset-Based: Owned its own fleet of transportation vehicles i.e. truck, airplanes, railroads and ocean freighters

Non-Asset-Based: without any of their own physical assets.

Freight Transportation
Multiple shipments: air, water, truck, and rail
· Truck segment: Ryder, Penske, and Emery Freight to small owner-operated trucking firm
· In competition: smaller firms developed specialty service or served niche markets
· Large firms expanded into multiple modes of transport and provide service across a wide range
· All shipper demanded Goals be transported safety& timely fashion
·......


View the rest of this paper...

Approximate Word Count: 2664
Approximate Pages: 11 (250 words per double-spaced page)

Why should you join Frat Files?

  • - It's safe, secure, and private.
  • - Instant access to over 100,000 papers. New papers are added hourly.
  • - Fast and reliable customer support.

Credit Card

PayPal

Bank Account

Similar Essays

  1. Nlm Analysis

    NLM Analysis Part I Logistic Business Transportation, Process to manufactures & 3 keys Shipper needs to ship product or goods by using Carrier to Receiver 3rd Party Logistics

  2. Ethical And Legal Aspects Of Healthcare

    use of gloves, protective equipment such as gowns, masks, and protective eye wear" (NLM Gateway, 2008). With all the protective gear there is still room for improvement to

  3. Parable Of Sadhu

    responsibility for the well-being of an individual? And what are the differen... www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=10167597&dopt=Abstract -

  4. Sequence Analysis

    Sequence analysis HES Biochemistry Sequence Analysis Assignment - May 2008 Unknown DNA sequence No. 63 orf63 $AAGCTTCAAATTAAGTCAGCTCCTTAAATGAAAGATAATAAAGTGTAGTTCAAGAACTAT

  5. Gene Therapy Analysis

    Gene Therapy Analysis I. Introduction Throughout history, humans have always asked the question of why, for example, why do offspring look similar to their parents. The answer to